For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 110 bp
Wild Type = 144 bp
>chr19:59042027-59042170 144bp GGTTTGTAGTTTGCATGTGTGC CCCCATGACCAAGAAGAATGT
Wt Sequence:
Mutant Sequence:
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
36741 | GGT TTG TAG TTT GCA TGT GTG C | Common | A | |||
36742 | TGC TTA CAG AAT CAT ATT CCA GGA C | Mutant Reverse | A | |||
36743 | CCC CAT GAC CAA GAA GAA TGT | Wild type Reverse | A | |||
36744 | Fluorophore-1 | ATG GGG AGG TGT AAG GTT CC | Quencher-1 | MUT Probe | ||
36745 | Fluorophore-2 | AGC CAA AGG TCT AGC TGT AGG A | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
36741 | 0.40 uM |
36742 | 0.40 uM |
36743 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |