For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 118 bp
Wild Type = 127 bp
>chr5:30199307-30199433 127bp CTCTCGTGGCTCCTGTCTCT GGCTCAAGGTACAGGGATAACA
Wt Sequence:
Mutant Sequence:
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
36727 | CTC TCG TGG CTC CTG TCT CT | Common | A | |||
36728 | CAC CAC CAC CAC CAC ATA GA | Mutant Reverse | A | |||
36729 | GGC TCA AGG TAC AGG GAT AAC A | Wild type Reverse | A | |||
36730 | Fluorophore-1 | AGT GGA TCC TCC AGG GAC A | Quencher-1 | MUT Probe | ||
36733 | Fluorophore-2 | CTG ACC TCT GAG TGG CTT GTC | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
36727 | 0.40 uM |
36728 | 0.40 uM |
36729 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |