For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 105 bp
Wild Type = 92 bp
>chr16:59429784+59429875 92bp TGAGAGACCAGCTCCATCCT GCATTATGAACTCGCTGACG
Wt Sequence:
Mutant Sequence:
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
36702 | TGA GAG ACC AGC TCC ATC CT | Common | A | |||
36703 | TCT ACA GAT TTC CAG AGG TCA GC | Mutant Reverse | A | |||
36704 | GCA TTA TGA ACT CGC TGA CG | Wild type Reverse | A | |||
36705 | Fluorophore-1 | TGT TCT GTA TAT TCC TGC TCT GTC C | Quencher-1 | MUT Probe | ||
36706 | Fluorophore-2 | ATG ATA TGC AAG CCA TGA AGA GTA | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
36702 | 0.40 uM |
36703 | 0.40 uM |
36704 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |