For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr12:72069605-72069705 101bp TGTGCTCTTCTTCCGAGAGG ACCCCTGCCCTTCTTAAA
Mutant= 83 bp
Wild Type = 101 bp
Wt Sequence: tgtgctcttcttccgagagggtccaccggactcagttatggaagtcggcaaactgcataattctgaaacCAgggacagcagcatttaagaagggc
Mutant Sequence: acgtcaaggttccaccagtcccgagtggtgaccgagtcccacccactccccgcagctgccgttctggtccgcacaacctttcaccctgctgcgggatgagcagagcggcggCAgggacagcagcatttaagaagggc
1370 bp deletion beginning at Chromosome 12 negative strand position 72071005 bp and ending after 72069636 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
36666 | TGT GCT CTT CTT CCG AGA GG | Wild type Forward | A | |||
36668 | Fluorophore-1 | ACC GGA CTC AGT TAT GGA AGT C | Quencher-1 | WT Probe | ||
37860 | GTT CTG GTC CGC ACA ACC | Mutant Forward | A | |||
37861 | ACC CCT GCC CTT CTT AAA TG | Common | A | |||
37862 | Fluorophore-2 | CTG CGG GAT GAG CAG AG | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
36666 | 0.40 uM |
37860 | 0.40 uM |
37861 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |