For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr4:99877844+99877947 104bp CCTCTCCTGGTGTACCATTC ATTTTCCTGAGCCAGACTGC
Mutant= 139 bp
Wild Type = 104 bp
Wt Sequence: cctctcctggtgtaccattcattttgactcAGagtgtgacctcactgattgatggctacgtttcactaggtcacttggggctgggcagtctggctcaggaaaat
Mutant Sequence: cctctcctggtgtaccattcattttgactcAAAGGGGGAaggtcactgagaatccaagaattagtcaccatttttagactttcctagcagtaaaaatctactagagtaaaatttttattgtgggattttacttggctagg
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
36661 | CCT CTC CTG GTG TAC CAT TC | Common | A | |||
36662 | ATT TTC CTG AGC CAG ACT GC | Wild type Reverse | A | |||
36663 | CCT AGC CAA GTA AAA TCC CAC A | Mutant Reverse | A | |||
36664 | Fluorophore-1 | TGT GAC CTC ACT GAT TGA TGG | Quencher-1 | WT Probe | ||
36665 | Fluorophore-2 | AGG TCA CTG AGA ATC CAA GAA TTA GT | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
36661 | 0.40 uM |
36662 | 0.40 uM |
36663 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |