Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr11:70972850+70972947 98bp TCATGAGACATGTGGCCAGT GGTTTAATCCCTGAGCAAGACA
Mutant= 94 bp
Wild Type = 98 bp
Wt Sequence: tcatgagacatgtggccagtTAatacttcatgtggagtgggaaaacaccactttctctctgctctgtctctgtttatgtcttgctcagggattaaacc
Mutant Sequence: tcatgagacatgtggccagtTCTGCTCAGAGAGgcagagtcttccctacctatgagaccgaccTCAGgcctggctcaggattaggtttgctgtt
215 bp deletion beginning at Chromosome 11 positive strand position 70,972,871 bp and ending after 70,973,085 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
36692 | TCA TGA GAC ATG TGG CCA GT | Common | A | |||
36693 | GGT TTA ATC CCT GAG CAA GAC A | Wild type Reverse | A | |||
36694 | AAC AGC AAA CCT AAT CCT GAG C | Mutant Reverse | A | |||
36695 | Fluorophore-1 | ATG TGG AGT GGG AAA ACA CC | Quencher-1 | WT Probe | ||
36696 | Fluorophore-2 | AGT CTT CCC TAC CTA TGA GAC CG | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
36692 | 0.40 uM |
36693 | 0.40 uM |
36694 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |