Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr19:10532545+10532671 127bp TGATGAACAACCAGCTCACA TCAATCAGTGCAGGCTTTTCT
Mutant= 118 bp
Wild Type = 127 bp
Wt Sequence: tgatgaacaaccagctcacatgtcagtcaaaattaaaataaattttagtcttaatccccAAacataggggttgtgggattagatgtgtttaatgtgtaggacaataagaaaagcctgcactgattga
Mutant Sequence: tgatgaacaaccagctcacatgtcagtcaaaattaaaataaattttagtcttaatccccATagtgggtgggcctaagaatgagatgtgtgtaaagaggacagtgctgggagtcaggtt
970 bp deletion beginning at Chromosome 19 positive strand position 10,532,605 bp and ending after 10,533,574 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
36402 | TGA TGA ACA ACC AGC TCA CA | Common | A | |||
36403 | TCA ATC AGT GCA GGC TTT TCT | Wild type Reverse | A | |||
36404 | AAC CTG ACT CCC AGC ACT GT | Mutant Reverse | A | |||
36405 | Fluorophore-1 | CAT AGG GGT TGT GGG ATT AGA TG | Quencher-1 | WT Probe | ||
36406 | Fluorophore-2 | TGG GCC TAA GAA TGA GAT GTG | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
36402 | 0.40 uM |
36403 | 0.40 uM |
36404 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |