For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mouse wt Exon 3 (Large1) = 88 bp
IPC = 74 bp
>chr8:73131860-73131947 88bp CACTCCAAGACCTACTCCATG CACACTCAGAGCTGTTACCTG
Plese note this is a qPCR for the deleted region so mouse wt will have two copies (hom-like); hets will have one copy (tg/o-like) and hom will have no copies (wt-like)
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
43488 | CAC TCC AAG ACC TAC TCC ATG | Forward | A | Exon 3 | ||
43489 | CAC ACT CAG AGC TGT TAC CTG | Reverse | A | Exon 3 | ||
43490 | Fluorophore-1 | ATT CTC ACT GTC CCC TGT CCC CT | Quencher-1 | Exon 3 | ||
oIMR1544 | CAC GTG GGC TCC AGC ATT | Internal Positive Control Forward | A | |||
oIMR3580 | TCA CCA GTC ATT TCT GCC TTT G | Internal Positive Control Reverse | A | |||
TmoIMR0105 | Fluorophore-2 | CCA ATG GTC GGG CAC TGC TCA A | Quencher-2 | IC Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
43488 | 0.40 uM |
43489 | 0.40 uM |
oIMR1544 | 0.40 uM |
oIMR3580 | 0.40 uM |
Tg Probe | 0.15 uM |
IC Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | repeat steps 2-3 for 40 cycles |