Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 124 bp
Wild Type = 118 bp
>chr1:132121962-132122079 118bp GCAGTATCAACAACGGCAGA TCTACAGCAACCACCCTGCT
Wt Sequence: AACCAACTCCACACTCAGACGAATGAGGGTGAGGGTCAGGCCACCTAGCTCTTTTCCACCCAGGCTCCCTGTGACCCTGATGACTAGCTGACATTGGgaagaaggggtgggggtgctctgggctgttcacatactctgggtgggaggtagggactgacacttgtcccactcagacatgccactcagtcttgtgggctgtcatcaggcgctttctcccccacagatggcacagatgagcctgagcagctgtctcctggcatgcagtatcaacaacggcagaaccagcgccgattctccatggaggtgagggtgcccctcccgggCTCCATGGGTCACACACGTCCACAGCAGTAAATTTAGCAGGGTGGTTGCTGTAGAGCCTGCCACTGGGGGGCTCAAACTGGTGCAGCTTATGGTGGGGGTTCAGTGAGAATATATGTCAAGTGCTAAAA
Deleted Region: gaagaaggggtgggggtgctctgggctgttcacatactctgggtgggaggtagggactgacacttgtcccactcagacatgccactcagtcttgtgggctgtcatcaggcgctttctcccccacagatggcacagatgagcctgagcagctgtctcctggcatgcagtatcaacaacggcagaaccagcgccgattctccatggaggtgagggtgcccctcccggg
226 bp deletion beginning at Chromosome 1 negative strand position 132,122,242 bp and ending after 132,122,017 bp (GRCm38/mm10). In addition there is a 17 bp intronic deletion 20 bp after the 226 bp deletion
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
37058 | AGG CCA CCT AGC TCT TTT CC | Mutant Forward | A | |||
37060 | GCA GTA TCA ACA ACG GCA GA | Wild type Forward | A | |||
37062 | Fluorophore-1 | CTC CCT GTG ACC CTG ATG A | Quencher-1 | MUT Probe | ||
37063 | Fluorophore-2 | CGA TTC TCC ATG GAG GTG A | Quencher-2 | WT Probe | ||
37672 | GTG GCA GGC TCT ACA GCA AC | Common | A |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
37058 | 0.40 uM |
37060 | 0.40 uM |
37672 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |