For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 80 bp
Wild Type = 128 bp
>chr2:85195944-85196071 128bp CCCTACAGATCGGGGGTAAC TTCTGCCTGGTGACCTGT
Wt Sequence:
Mutant Sequence:
702 bp deletion beginning at Chromosome 2 negative strand position 85,196,683 bp and ending after 85,195,982 bp (GRCm38/mm10). This mutation deletes 702 bp from ENSMUSE00000643986 (exon 1) including the ATG start site but retains the last 3 bp (CGG) in the exon
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
36610 | AGC AGC ATC CCT GTA ACT TGA | Mutant Forward | A | |||
36611 | TTC TGC CTG GTG ACC TGT | Common | A | |||
36612 | CCC TAC AGA TCG GGG GTA AC | Wild type Forward | A | |||
36613 | Fluorophore-1 | AGG GAC ACC GCG GGT A | Quencher-1 | MUT Probe | ||
36614 | Fluorophore-2 | CAT GGA GCC CTT GCT GAA | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
36610 | 0.40 uM |
36611 | 0.40 uM |
36612 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |