For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 031072
Protocol 30919: Probe Assay - Retnlg<em1(IMPC)J> Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr16:48872792+48872881 90bp GTCCTTTCCCTTACAGCCATC ATCTTGTTGAAAGTCAGCATCC
Mutant= 105 bp
Wild Type = 90 bp
Sequence
Wt Sequence: gtcctttcccttacagccatccCAtagctcagtgatctcatcttttctgctctttctctccagCCCTAGGATGCTGACTTTCAACAAGAT
Mutant Sequence: gtcctttcccttacagccatccCTgtacataaatcctaaaatcccctgtaccctggtctaagctcttagtcctctccatccctgccttcctgaccagggcttctt
243 bp deletion beginning at Chromosome 16 positive strand position 48,872,815 bp ATAGCTCAGTGATCTCATCT, and ending after GAGCTTTTGCTGATGCTGAC at 48,873,057 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35773 | GTC CTT TCC CTT ACA GCC ATC | Common | A | |||
| 35774 | ATC TTG TTG AAA GTC AGC ATC C | Wild type Reverse | A | |||
| 35775 | AAG AAG CCC TGG TCA GGA AG | Mutant Reverse | A | |||
| 35776 | Fluorophore-1 | CTG CTC TTT CTC TCC AGC CC | Quencher-1 | WT Probe | ||
| 35777 | Fluorophore-2 | CCC TGT ACC CTG GTC TAA GCT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35773 | 0.40 uM |
| 35774 | 0.40 uM |
| 35775 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.