Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr7:28268554+28268655 102bp CCAGAGGGTGGATTTTGACA TGGATGAACTTATCGCAACC
Mutant= 91 bp
Wild Type = 102 bp
Wt Sequence: CCAGAGGGTGGATTTTGACATTTTAACGTTTACCATAGCCCTGACTGCATCAGAGGTGATCAATCCTCTAATAGAAGaactgggttgcgataagttcatcca
Mutant Sequence: gttcttcccgggtctcagcgagcagcggtgctgaccccgcggtccgacatgtcgcagctgcccgcAAactgggttgcgataagttcatcca
658 bp deletion beginning at Chromosome 7 positive strand position 28267973 bp GTCAGCAGCGCCCCGCAGAC, and ending after GATCAATCCTCTAATAGAAG at 28268630 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
35739 | GTT CTT CCC GGG TCT CAG C | Mutant Forward | A | |||
35740 | TGG ATG AAC TTA TCG CAA CC | Common | A | |||
35741 | CCA GAG GGT GGA TTT TGA CA | Wild type Forward | A | |||
35742 | Fluorophore-1 | ACG TTT ACC ATA GCC CTG ACT G | Quencher-1 | WT Probe | ||
35743 | Fluorophore-2 | GGT CCG ACA TGT CGC AG | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
35739 | 0.40 uM |
35740 | 0.40 uM |
35741 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |