For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 031038
Protocol 30720: Probe Assay - Stk35<em1(IMPC)J> Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:129626907+129627017 111bp ACGGATAAGTCGGCGAGAG GAATTGAACGGGGGAAGG
Mutant= 116 bp
Wild Type = 111 bp
Sequence
Wt Sequence: acggataagtcggcgagaggggacggtttgcgcttcggtttccggtcctccctcgGTacttcccggtggttccgtctttcccgctttcctttcccttcccccgttcaattc
Mutant Sequence: acggataagtcggcgagaggggacggtttgcgcttcggtttccggtcctccctcgGTggtgggattcaaagtagttggtagaactgcagaagccccctcatgcctctttctcatca
1047 bp deletion beginning at Chromosome 2 positive strand position 129,801,227 bp TACTTCCCGGTGGTTCCGTC, and ending after AGATGGATGAAGAGTAGTCC at 129,802,273 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35278 | ACG GAT AAG TCG GCG AGA G | Common | A | |||
| 35279 | GAA TTG AAC GGG GGA AGG | Wild type Reverse | A | |||
| 35280 | TGA TGA GAA AGA GGC ATG AGG | Mutant Reverse | A | |||
| 35281 | Fluorophore-1 | CCG GTG GTT CCG TCT TT | Quencher-1 | WT Probe | ||
| 35282 | Fluorophore-2 | CGG TGG TGG GAT TCA AAG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35278 | 0.40 uM |
| 35279 | 0.40 uM |
| 35280 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.