Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr2:129626907+129627017 111bp ACGGATAAGTCGGCGAGAG GAATTGAACGGGGGAAGG
Mutant= 116 bp
Wild Type = 111 bp
Wt Sequence: acggataagtcggcgagaggggacggtttgcgcttcggtttccggtcctccctcgGTacttcccggtggttccgtctttcccgctttcctttcccttcccccgttcaattc
Mutant Sequence: acggataagtcggcgagaggggacggtttgcgcttcggtttccggtcctccctcgGTggtgggattcaaagtagttggtagaactgcagaagccccctcatgcctctttctcatca
1047 bp deletion beginning at Chromosome 2 positive strand position 129,801,227 bp TACTTCCCGGTGGTTCCGTC, and ending after AGATGGATGAAGAGTAGTCC at 129,802,273 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
35278 | ACG GAT AAG TCG GCG AGA G | Common | A | |||
35279 | GAA TTG AAC GGG GGA AGG | Wild type Reverse | A | |||
35280 | TGA TGA GAA AGA GGC ATG AGG | Mutant Reverse | A | |||
35281 | Fluorophore-1 | CCG GTG GTT CCG TCT TT | Quencher-1 | WT Probe | ||
35282 | Fluorophore-2 | CGG TGG TGG GAT TCA AAG | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
35278 | 0.40 uM |
35279 | 0.40 uM |
35280 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |