Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr9:75524241-75524345 105bp AGCACACACACCCATCACAC TCCCTCTGAAGTCTTTCCTGA
Mutant= 136 bp
Wild Type = 105 bp
Wt Sequence: agcacacacacccatcacacaagctgcttgagagtcagaggagctgcgcagcttgccagggaatgtctaGTgcccagctggaagtcaggaaagacttcagaggga
Mutant Sequence: gccaggctgacatagtaggatgctatctctaaatagatggatgataaattaattaattaaatgcaatgaaaaagttaagtatttcaaaaagggataggttATgcccagctggaagtcaggaaagacttcagaggga
406 bp deletion beginning at Chromosome 9 negative strand position 75,676,874 bp, TGAAATGATGCGTGGACTAG, and ending after GCTTGCCAGGGAATGTCTAG at 75,676,469 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
35270 | Fluorophore-1 | AGG GAT AGG TTA TGC CCA GC | Quencher-1 | MUT Probe | ||
35271 | AGC ACA CAC ACC CAT CAC AC | Wild type Forward | A | |||
35272 | TCC CTC TGA AGT CTT TCC TGA | Common | A | |||
35273 | GCC AGG CTG ACA TAG TAG GA | Mutant Forward | A | |||
35274 | Fluorophore-2 | AGG AGC TGC GCA GCT T | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
35271 | 0.40 uM |
35272 | 0.40 uM |
35273 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |