For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 031026
Protocol 30712: Probe Assay - Rgsl1<em1(IMPC)J> Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr1:155651937-155652042 106bp CTTGCAAATTGTAGAAGGCTCA GAGGGGGAAAGGAGAGTCA
Mutant= 108 bp
Wild Type = 106 bp
Sequence
Wt Sequence: cttgcaaattgtagaaggctcagtgaggccagaataataccagagtcatgagccttTCtcatgaaaccaccaaactatggacagaaatgactctcctttccccctc
Mutant Sequence: cttgcaaattgtagaaggctcagtgaggccagaataataccagagtcatgagccttTCtcccagacctcatagtgtactgctagagctgtcctacaaaagaaacacca
321 bp deletion spanning ENSMUSE00001254521 (exon 12) beginning at Chromosome 1 negative strand position 153,804,855 bp, CTCATGAAACCACCAAACTA, and ending after AAGCCACATTAAGCAAAGAT at 153,804,535 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35265 | Fluorophore-1 | CAT GAA ACC ACC AAA CTA TGG AC | Quencher-1 | WT Probe | ||
| 35266 | Fluorophore-2 | CCC AGA CCT CAT AGT GTA CTG CTA G | Quencher-2 | MUT Probe | ||
| 35267 | CTT GCA AAT TGT AGA AGG CTC A | Common | A | |||
| 35268 | GAG GGG GAA AGG AGA GTC A | Wild type Reverse | A | |||
| 35269 | TGG TGT TTC TTT TGT AGG ACA GC | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35267 | 0.40 uM |
| 35268 | 0.40 uM |
| 35269 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.