Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr13:4242050+4242209 160bp GAAATGTTGCTGGTCCAAGG TGGATCATTCAAGAGAACTGGA
Mutant= 153 bp
Wild Type = 160 bp
Wt Sequence: gaaatgttgctggtccaaggactcctttgaagacccctagttttgagtgggtaccctatgaGTtcagaagcctcctaaagattctcaacctttgaagctaaagatttctgccttttcttctagGGTAGACCCAAGCTCTCCAGTTCTCTTGAATGATCCA
Mutant Sequence: tcaagccaacactatgctttctgtttgtaatttgcaaaacagaattaaactccaaGTtcagaagcctcctaaagattctcaacctttgaagctaaagatttctgccttttcttctagGGTAGACCCAAGCTCTCCAGTTCTCTTGAATGATCC
520 bp deletion beginning at Chromosome 13 positive strand position 4,242,346 bp GTGTGGCTCATAGAACTGGA, and ending after TTGAGTGGGTACCCTATGAG at 4,242,865 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
35255 | Fluorophore-1 | CCT TTG AAG ACC CCT AGT TTT G | Quencher-1 | WT Probe | ||
35256 | Fluorophore-2 | TGC AAA ACA GAA TTA AAC TCC AAG | Quencher-2 | MUT Probe | ||
35257 | GAA ATG TTG CTG GTC CAA GG | Wild type Forward | A | |||
35258 | TGG ATC ATT CAA GAG AAC TGG A | Common | A | |||
35259 | CAA GCC AAC ACT ATG CTT TCT G | Mutant Forward | A |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
35257 | 0.40 uM |
35258 | 0.40 uM |
35259 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |