For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 95 bp
Wild Type = 102 bp
>chr14:56270095+56270196 102bp TGTATCCACTGTGTGAGAGCAC AAAGCCATGGAGTTGTGAGC
Wt Sequence:tgtatccactgtgtgagagcactttatacacaatggtgaactagtggtcctcaggtaccatcctctctcccttttgggCtctgctcacaactccatggcttt
Mutant Sequence:CCACGTGAGATACAGgtcagaaagggagctgaaagaaggaacttaggcttattaataagctacttgaggtACtctgctcacaactccatggcttt
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
35305 | CCA CGT GAG ATA CAG GTC AGA | Mutant Forward | A | |||
35306 | AAA GCC ATG GAG TTG TGA GC | Common | A | |||
35307 | TGT ATC CAC TGT GTG AGA GCA C | Wild type Forward | A | |||
35308 | Fluorophore-1 | AGC TGA AAG AAG GAA CTT AGG CTT A | Quencher-1 | MUT Probe | ||
35309 | Fluorophore-2 | CAG GTA CCA TCC TCT CTC CCT T | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
35305 | 0.40 uM |
35306 | 0.40 uM |
35307 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |