Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr9:114538221-114538328 108bp TGCTGTTTGTTTCCTTGCTG GCATGCTGTTCTCAACATCG
Mutant= 120 bp
Wild Type = 108 bp
Wt Sequence: tgctgtttgtttccttgctgttgttagagtgCAttctgcccggattgtttcagGTCCACTCGGCTGTTGAAGAGATGGATGGGTTAGACGATGTTGAGAACAGCATGC
Mutant Sequence: tgctgtttgtttccttgctgttgttagagtgCTatatgttagcatttaaagggggagaaagaatgggagaaatacataactcagtagagtgcttgccctgtgagtgtgagggcctgcatt
234 bp deletion spanning ENSMUSE00000448470 (exon 4) beginning at Chromosome 9 negative strand position 114,629,178 bp ATTCTGCCCGGATTGTTTCA, and ending after TAGATGACCTAAATCTGAGC at 114,628,945 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
35241 | Fluorophore-1 | CTC AGT AGA GTG CTT GCC CTG | Quencher-1 | MUT Probe | ||
35242 | TGC TGT TTG TTT CCT TGC TG | Common | A | |||
35243 | AAT GCA GGC CCT CAC ACT | Mutant Reverse | A | |||
35244 | GCA TGC TGT TCT CAA CAT CG | Wild type Reverse | A | |||
35245 | Fluorophore-2 | AGG TCC ACT CGG CTG TTG | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
35242 | 0.40 uM |
35243 | 0.40 uM |
35244 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |