For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr2:113685631-113685724 94bp ACTGGCTGAATGCGCTAGA CGCAAGTAACTCCAAGAATTATGC
Mutant= 100 bp
Wild Type = 94 bp
Wt Sequence:
Mutant Sequence:
322 bp deletion beginning at Chromosome 2 positive strand position 113,845,222 bp TGAGATATTCTCTCCATTTT, and ending after AGATTAAAACACTGCCTTCA at 113,845,543 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
35166 | Fluorophore-1 | AAC AGC TGC TGT GTA CAT TTG C | Quencher-1 | MUT Probe | ||
35167 | ACT GGC TGA ATG CGC TAG A | Common | A | |||
35168 | ACA CTC AGA GAG GAA ATA ATG TGG | Mutant Reverse | A | |||
35169 | CGC AAG TAA CTC CAA GAA TTA TGC | Wild type Reverse | A | |||
35170 | Fluorophore-2 | AGG CAG TGT TTT AAT CTT GGT GTC | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
35167 | 0.40 uM |
35168 | 0.40 uM |
35169 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |