For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mut= 110 bp
Wt= 108 bp
Wt Sequence:
Mutant Sequence:
235 bp deletion beginning at Chromosome 2 positive strand position 93,198,127 bp, TTGGGGAAAACATTTATGTT, and ending after GGATGGTTTTGTGTCCCGGG at 93,198,361 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
34979 | AGG CAG GAG AGG TTG AGC TT | Common | A | |||
34981 | Fluorophore-1 | CTG GGC CTT GCT CTG AAT TA | Quencher-1 | MUT Probe | ||
34982 | Fluorophore-2 | CCC AGG TGT CCA CAG GAG | Quencher-2 | WT Probe | ||
34983 | AAC AGC CAG GGC TAT TTG AG | Mutant Reverse | A | |||
34984 | TCT CAC CCA CCC ACC TTC | Wild type Reverse | A |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
34979 | 0.40 uM |
34983 | 0.40 uM |
34984 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |