Protocol 30598: Probe Assay - Slc9a9<em1(IMPC)J>-Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mut=114 bp

Wt= 114 bp

Sequence

Wt Sequence:

 

Mutant Sequence:

563 bp deletion beginning at Chromosome 9 positive strand position 94,684,901 bp, GTAAGTATCTGTGAGTAAAC, and ending after TTTTCCAGCAAGCCAGGGCT at 94,685,463 bp (GRCm38/mm10).In addition there is a 19 bp deletion (AGTCAGTAATGTCCGTGAC) 25 bp before the 563 bp deletion that will not alter the results of the exon deletion.

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
34974 TTC CAA CGA CAC ATC CCA AT Common A
34975 Fluorophore-1 AAT GGC CCT GTG TTT TCT CA Quencher-1 WT Probe
34976 Fluorophore-2 TTC TTG AGA TGT ACC CCA GTG Quencher-2 MUT Probe
34977 GCA ACA CTA AAG GCA CCC ATA Mutant Reverse A
34978 AAG CAC ACG TTT GAC TTG GA Wild type Reverse A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
34974 0.40 uM
34977 0.40 uM
34978 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.