For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mut=114 bp
Wt= 114 bp
Wt Sequence:
Mutant Sequence:
563 bp deletion beginning at Chromosome 9 positive strand position 94,684,901 bp, GTAAGTATCTGTGAGTAAAC, and ending after TTTTCCAGCAAGCCAGGGCT at 94,685,463 bp (GRCm38/mm10).In addition there is a 19 bp deletion (AGTCAGTAATGTCCGTGAC) 25 bp before the 563 bp deletion that will not alter the results of the exon deletion.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
34974 | TTC CAA CGA CAC ATC CCA AT | Common | A | |||
34975 | Fluorophore-1 | AAT GGC CCT GTG TTT TCT CA | Quencher-1 | WT Probe | ||
34976 | Fluorophore-2 | TTC TTG AGA TGT ACC CCA GTG | Quencher-2 | MUT Probe | ||
34977 | GCA ACA CTA AAG GCA CCC ATA | Mutant Reverse | A | |||
34978 | AAG CAC ACG TTT GAC TTG GA | Wild type Reverse | A |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
34974 | 0.40 uM |
34977 | 0.40 uM |
34978 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |