For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr8:74692133+74692229 97bp GACAGGAGCAGCAGAAAGGT TTCCCTGCTAGAAGCACAGC
Mutant= 111 bp
Wild Type = 97 bp
Wt Sequence: gacaggagcagcagaaaggtggagcgcatctcccattcccagcttcCCttcagctactgttgtcgccacagccttaggctgtgcttctagcagggaa
Mutant Sequence: gacaggagcagcagaaaggtggagcgcatctcccattcccagcttcCCtgaatcgtggcccttcgctggactctacactgggagcagagctgttggtgcccttccacatat
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
34815 | GAC AGG AGC AGC AGA AAG GT | Common | A | |||
34816 | TTC CCT GCT AGA AGC ACA GC | Wild type Reverse | A | |||
34817 | ATA TGT GGA AGG GCA CCA AC | Mutant Reverse | A | |||
34818 | Fluorophore-1 | AGC TAC TGT TGT CGC CAC AG | Quencher-1 | WT Probe | ||
34819 | Fluorophore-2 | CCC TTC GCT GGA CTC TAC AC | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
34815 | 0.40 uM |
34816 | 0.40 uM |
34817 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |