For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 030817
Protocol 30358: Probe Assay - Msl3<em1(IMPC)J> Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chrX:168670520-168670657 138bp GCTAGCAAAGCTTCACAGATCC CACACAAGCTAATGATCTGAAAGTG
Mutant= 155 bp
Wild Type = 138 bp
Sequence
Wt Sequence: gctagcaaagcttcacagatccttcctcttggatcattttcttcttgagacctccagggcctTGccaccactgatgaacccaacagtgaaccataggatcctagctggtgaaacactttcagatcattagcttgtgtg
Mutant Sequence: gctagcaaagcttcacagatccttcctcttggatcattttcttcttgagacctccagggcctTCcacaagctatgtatttttttaagtacgattgtgaactatacttcataatgactaatttttaatggtacataacagagattggcttctgcc
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 34423 | GCT AGC AAA GCT TCA CAG ATC C | Common | A | |||
| 34424 | CAC ACA AGC TAA TGA TCT GAA AGT G | Wild type Reverse | A | |||
| 34425 | AGG CAG AAG CCA ATC TCT GT | Mutant Reverse | A | |||
| 34426 | Fluorophore-1 | AAC CCA ACA GTG AAC CAT AGG A | Quencher-1 | WT Probe | ||
| 34427 | Fluorophore-2 | CAG GGC CTT CCA CAA GC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 34423 | 0.40 uM |
| 34424 | 0.40 uM |
| 34425 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.