For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mut= 118 bp
Wt= 104 bp
321 bp deletion beginning at Chromosome 14 positive strand position 31,136,450 bp CAGGGGCCCTTGACTAAGTA, and ending after GGGGCTAGAGCCAACGGCAC at 31,136,770 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
34165 | AGA AGA CAC GGG CAC AAA AC | Common | A | |||
34166 | CTT ATC CCT GTA AAG GCC CAT C | Wild type Reverse | A | |||
34167 | CAG GCA TGT GAC CAA AAG G | Mutant Reverse | A | |||
34168 | Fluorophore-1 | CCT TGC TGG TCA GTG TCC TA | Quencher-1 | WT Probe | ||
34169 | Fluorophore-2 | CAG GGC AGG ACT GTT AGG AA | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
34165 | 0.40 uM |
34166 | 0.40 uM |
34167 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |