Protocol 30241: Probe Assay - Nt5dc2<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mut= 118 bp

Wt= 104 bp

321 bp deletion beginning at Chromosome 14 positive strand position 31,136,450 bp CAGGGGCCCTTGACTAAGTA, and ending after GGGGCTAGAGCCAACGGCAC at 31,136,770 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
34165 AGA AGA CAC GGG CAC AAA AC Common A
34166 CTT ATC CCT GTA AAG GCC CAT C Wild type Reverse A
34167 CAG GCA TGT GAC CAA AAG G Mutant Reverse A
34168 Fluorophore-1 CCT TGC TGG TCA GTG TCC TA Quencher-1 WT Probe
34169 Fluorophore-2 CAG GGC AGG ACT GTT AGG AA Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
34165 0.40 uM
34166 0.40 uM
34167 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.