For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr7:52451576-52451673 98bp AACTCAGGAGAGGGACTTGC AGGCCACGGTTTAAGAACAG
Mutant= 96 bp
Wild Type = 98 bp
Wt Sequence: aactcaggagagggacttgccccaggtggctctgcatgctgtagggcaggcgtgtcatCAacctgctgatgacagacactgttcttaaaccgtggcct
Mutant Sequence: aactcaggagagggacttgccccaggtggctctgcatgctgtagggcaggcgtgtcatCTgagaaccagctgccttgggtgatggtgcaggggtcc
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
33945 | AAC TCA GGA GAG GGA CTT GC | Common | A | |||
33946 | GGA CCC CTG CAC CAT CAC | Mutant Reverse | A | |||
33947 | AGG CCA CGG TTT AAG AAC AG | Wild type Reverse | A | |||
33948 | Fluorophore-1 | CTG AGA ACC AGC TGC CTT G | Quencher-1 | MUT Probe | ||
33949 | Fluorophore-2 | TCA TCA ACC TGC TGA TGA CAG | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
33945 | 0.40 uM |
33946 | 0.40 uM |
33947 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |