For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr3:40774103+40774275 173bp ATGGTGTGCATGTGGAAATCT TTACTGTCAAACTAAAATGATTAGCTG
Mutant= 178 bp
Wild Type = 173 bp
Wt Sequence: ttgcaggagttggttctctctaccacgTGtgatctggaggttatatgcagggtattagcttggtgacatgtcctttccctgctgagctatttcagtagtcctctgacacgatgggtcagctaatca
Mutant Sequence: ttgcaggagttggttctctctaccacgTAaggtatgaaaaaaaaaagactaaaacttctgtatattatttaaaataaataaaatgtgtcttatttgcaaatagatatttatattaaaatttgtaaacaagcagggtatggtacatgtc
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
33927 | GAC ATG TAC CAT ACC CTG CTT G | Mutant Reverse | A | |||
33928 | Fluorophore-1 | TGA TCT GGA GGT TAT ATG CAG G | Quencher-1 | WT Probe | ||
35924 | ATG GTG TGC ATG TGG AAA TCT | Common | A | |||
35925 | TTA CTG TCA AAC TAA AAT GAT TAG CTG | Wild type Reverse | A | |||
35926 | Fluorophore-2 | ATG TGT CTT ATT TGC AAA TAG ATA TTT AT | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
33927 | 0.40 uM |
35924 | 0.40 uM |
35925 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |