For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr13:32816974-32817057 84bp TCCAGCCCCAGAAATATGAC CACAAACTCTTTGGGGTCAC
Mutant= 84 bp
Wild Type = 91 bp
Wt Sequence: tccagccccagaaatatgactgccttGGaacttcagatttctcgctgttttgcattgtctaaatgtgaccccaaagagtttgtg
Mutant Sequence: tccagccccagaaatatgactgccttGGctttatttgccatgtcataaagtctgagagtaggaaaaacccagtgtgactcgccaaaaggtc
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
33917 | TCC AGC CCC AGA AAT ATG AC | Common | A | |||
33918 | CAC AAA CTC TTT GGG GTC AC | Wild type Reverse | A | |||
33919 | GAC CTT TTG GCG AGT CAC AC | Mutant Reverse | A | |||
33920 | Fluorophore-1 | CCT TGG AAC TTC AGA TTT CTC G | Quencher-1 | WT Probe | ||
33922 | Fluorophore-2 | CCA TGT CAT AAA GTC TGA GAG TAG G | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
33917 | 0.40 uM |
33918 | 0.40 uM |
33919 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |