For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr10:86267747+86267837 91bp CCCCTTTGGTGTCTGAAGAG ACCCTGCAGCCACTCACTAC
Mutant= 108 bp
Wild Type = 91 bp
Wt Sequence: cccctttggtgtctgaagagtagacagccctgcgcattcatgcccagaccctgcCCttgtacagaaactctgtagtgagtggctgcagggt
Mutant Sequence: tgtaccactgagctgcatccccagacttggatctgcccgttctgaacattatatggatgtgcaaactgctcCCttgtacagaaactctgtagtgagtggctgcagggt
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
33912 | CCC CTT TGG TGT CTG AAG AG | Wild type Forward | A | |||
33913 | ACC CTG CAG CCA CTC ACT AC | Common | A | |||
33914 | TGT ACC ACT GAG CTG CAT CC | Mutant Forward | A | |||
33915 | Fluorophore-1 | TTG GAT CTG CCC GTT CTG | Quencher-1 | MUT Probe | ||
33916 | Fluorophore-2 | CGC ATT CAT GCC CAG AC | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
33912 | 0.40 uM |
33913 | 0.40 uM |
33914 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |