For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr17:46382899-46383008 110bp ACGCTTTTCTCAAAGCCATC ACTAAAGGCGTGTGGCTCAG
Mutant= 97 bp
Wild Type = 110 bp
Wt Sequence: acgcttttctcaaagccatcccTCtggggcaggtagggtggttcacacctatgacagtctgggctacatagtaaacattgtatcaagaatctgagccacacgcctttagt
Mutant Sequence: acgcttttctcaaagccatcccTCtgggagaacagctgtccccaccccacctctagtctcactgtgtacaccctcggaacacagcgctagcagcact
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
33901 | ACG CTT TTC TCA AAG CCA TC | Common | A | |||
33902 | ACT AAA GGC GTG TGG CTC AG | Wild type Reverse | A | |||
33903 | AGT GCT GCT AGC GCT GTG T | Mutant Reverse | A | |||
33906 | Fluorophore-1 | CAC ACC TAT GAC AGT CTG GGC | Quencher-1 | WT Probe | ||
33907 | Fluorophore-2 | CCC CAC CTC TAG TCT CAC TGT G | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
33901 | 0.40 uM |
33902 | 0.40 uM |
33903 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |