For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mut=110 bp
Wt= 125 bp
WT Sequence: tggctggctctcttcatttttataatctgaaagaagtatttgttgtctctcaagggactcaagaaatgtcatTTTCTTTCCCCACCCATGTCtagaatgaattacgcaatagatacagaatatga
MUT Sequence: acataattgaaagtgcccatatacagatactatacacctcattgagaactcatccacatatttgagtaatagatctagaatgaattacgcaatagatacagaatatga
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
32192 | ACA TAA TTG AAA GTG CCC ATA TAC AG | Mutant Forward | A | |||
32193 | Fluorophore-1 | CAC CTC ATT GAG AAC TCA TCC A | Quencher-1 | MUT Probe | ||
32194 | TGG CTG GCT CTC TTC ATT TT | Wild type Forward | A | |||
32195 | Fluorophore-2 | TCT TTC CCC ACC CAT GTC TA | Quencher-2 | WT Probe | ||
32196 | TCA TAT TCT GTA TCT ATT GCG TAA TTC | Common | A |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
32192 | 0.40 uM |
32194 | 0.40 uM |
32196 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |