For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 028573
Protocol 42698: Probe Assay - Gt(ROSA)26Sor<em#Mvw> (generic)
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 122 bp
Wild Type = 71 bp
>chr6:113075985-113076055 71bp GATCTGCAACTCCAGTCTTTCT ACACCAGGTTAGCCTTTAAGC
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 61347 | GAT CTG CAA CTC CAG TCT TTC T | Forward | A | |||
| 61348 | ACA CCA GGT TAG CCT TTA AGC | Reverse | A | |||
| 61349 | Fluorophore-1 | AGA AGA TGG GCG GGA GTC | Quencher-1 | WT Probe | ||
| 61350 | Fluorophore-2 | CAG TGG TGT ACG GTA CAA ACC GG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 61347 | 0.40 uM |
| 61348 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 037406 | 129S1/SvImJ-Gt(ROSA)26Sorem12Mvw/Mmjax |
| 037407 | A/J-Gt(ROSA)26Sorem18Mvw/Mmjax |
| 028573 | C57BL/6J-Gt(ROSA)26Sorem2Mvw/Mmjax |
| 037409 | DBA/2J-Gt(ROSA)26Sorem14Mvw/Mmjax |
| 037410 | FVB/NJ-Gt(ROSA)26Sorem20Mvw/Mmjax |
| 037412 | NZO/HlLtJ-Gt(ROSA)26Sorem31Mvw/Mmjax |
| 037413 | PWK/PhJ-Gt(ROSA)26Sorem19Mvw/Mmjax |
| 7 strains use this protocol | |