Stock No: 370476
Protocol 37962: Probe Assay - Htt<tm1.1Mfc> presence/absence-Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  57 bp

Wild Type = 54 bp

>chr5:34761907+34761960 54bp ATGGCAACCCTGGAAAAGC CTGAAACGACTTGAGCGACT

Sequence

Wt Sequence:

ATGGCAACCCTGGAAAAGCTGATGAAGGCTTTCGAGTCGCTCAAGTCGTTTCAG

Mutant Sequence:

ATGGCAACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGTCCTTCCAGCAG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
52342 CTG AAA CGA CTT GAG CGA CT Wild type Reverse A
52343 CTG CTG GAA GGA CTT GAG G Mutant Reverse A
52636 ATG GCA ACC CTG GAA AAG C Common A
52637 Fluorophore-1 TGA TGA AGG CTT TCG AGT CG Quencher-1 WT Probe
52638 Fluorophore-2 ATG AAG GCC TTC GAG TCC C Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00
Kapa Probe Fast QPCR 1.00 X
ddH2O
ddH2O
Primer 0.42
52342 0.40 uM
Primer 0.42
52343 0.40 uM
Primer 0.42
52636 0.40 uM
Primer 0.42
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA
Probe 0.17
Probe 0.17
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
1 95.0 --
2 95.0 --
2 95.0 --
3 60.0 -- repeat steps 2-3 for 40 cycles
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
029928 B6J.129S1-Htttm1.1Mfc/190ChdiJ
370476 B6J.129S1-Htttm1Mfc/190JChdi
2 strains use this protocol