Stock No: 370476
Protocol 37857: Separated PCR Assay - Htt<tm1.1Mfc> presence/absence
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = ~140 bp
Heterozygote = ~140 bp and 141 bp
Wild type = 141 bp

>chr5:34761820+34761960 141bp CATTCATTGCCTTGCTGCTA CTGAAACGACTTGAGCGACT

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
52341 CAT TCA TTG CCT TGC TGC TA Common A, B
52342 CTG AAA CGA CTT GAG CGA CT Wild type Reverse A
52343 CTG CTG GAA GGA CTT GAG G Mutant Reverse B

Reaction A

Component Final Concentration
ddH2O
ddH2O
Kapa 2G HS buffer 1.00
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
MgCl2 2.00
dNTPS-kapa 0.26 mM
dNTPS-kapa 0.20
52341 0.50
52341 0.50 uM
52342 0.50 uM
52342 0.50
10x Loading Dye 0.50
Glycerol 6.50 %
Kapa 2G HS taq polym 0.01
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Reaction B

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
52341 0.50 uM
52343 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
029928 B6J.129S1-Htttm1.1Mfc/190ChdiJ
370476 B6J.129S1-Htttm1Mfc/190JChdi
2 strains use this protocol