Stock No: 035800
Protocol 40178: Standard PCR Assay - Ace2<tm1.1(ACE2)Mdk>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

chrX:162930873+162931173 301bp CCCCACCACCACCTTTTATT ACTGGACCACCAACCAAAGA

Mutant = 215 bp
Heterozygote = 215 bp and 301 bp
Wild type = 301 bp

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
55427 CCC CAC CAC CAC CTT TTA TT Wild type Forward A
55428 ACT GGA CCA CCA ACC AAA GA Wild type Reverse A
55429 TTA ACC ACG AAG CCG AAG AC Mutant Forward A
55430 ATG GAG GCA AAC ATC CAA TC Mutant Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
55427 0.50 uM
55428 0.50 uM
55429 0.50 uM
55430 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.