Protocol 36809: Standard PCR Assay - Tc(HSA17)1Mdk SPPL2C
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr11:104188843+104189134 292bp GCTCATCCCCAATTTCTTGA GTTGTTGCCTGTCCCAGACT

Mutant = 163 bp
Heterozygote = 163 bp and 292 bp
Wild type = 292 bp

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
49779 GCT CAT CCC CAA TTT CTT GA Wild type Forward A Wt F
49780 GTT GTT GCC TGT CCC AGA CT Wild type Reverse A Wt R
49781 CGC AGA TGT TGC AGT AGG AA Mutant Forward A Mut F
49782 TCG GAG CTG AAC AGG ATA CA Mutant Reverse A Mut R

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
49779 0.50 uM
49780 0.50 uM
49781 0.50 uM
49782 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
036664 B6(Cg)-Tc(HSA17*)1Mdk/J
038908 B6.Cg-Tc(HSA17)2Mdk Appem1Adiuj/J
039175 B6J.B6N(CBA)-Tc(HSA17)1Mdk Psen1tm1.1(PSEN1)Mdk Apptm1.1(APP)Mdk/J
033668 B6J.B6N(CBA)-Tc(HSA17)1Mdk/J
035794 B6J.B6N(Cg)-Tc(HSA17*N279K)1Mdk/J
035398 B6J.B6N-Tc(HSA17)2Mdk/J
037420 B6J.B6N-Tc(HSA17*P301L)1Mdk/J
7 strains use this protocol