Protocol 39812: Probe Assay - Thap12<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr7:98716402+98716500 99bp TGAACAGCACCTCAAAGCTC TACATGTCAGCATGGTGCTCT

Mut = 95 bp

Wt = 99 bp

Fam = Mut

Hex = Wt

 

Sequence

WT Sequence (deletions in lower case):

TTTGTGGATTTCATTTCTATCCCTGTAACTGTCTGTATCTGTGGCCTTGGGCAAGTTATTTACAGTCCTTATTTGTCAGAGGGATTGATACCATCTTCCTGAAGAAAgtaacgtgatccccgtaaagtgctggccacagtgcctgtaggaatggttgttctcctcaccttcctttttctcatggcatggattttgtttattaaaatctgtctgcagcatttgtccctttctaacttatttttgtgtcctactttgttaatgttctattagtggtgaatgaatgcatttgtggattttaaatatttagccaatcaaaagtaatttgttttgtcgtttgtggttcttcatgagtctgtttataaaagtaactttttgttttccagttgaggagacttctgaacaagagcaggaaactaacaccaatgctcagaaccccagtgcagaagcggtgaaccagcaggatgcaaatgtgctgcctttaacccttgaagagaaggagaacaaagagtacctcaagtctttatttgagattctggttctcatgggaaagcagaacatccccttggatgggcacgaggctgacgaggtccccgagggcctctttgccccagacaacttccaggcgctcctggagtgccgcatcaactctggcgaggaggtcctaaggaagcgctttgaggccacagcggtcaacacattattctgctctaaaactcagcagaggcacatgctggagatctgtgagagctgcattcgggaggagactctcagggaagtgagggactcacacttcttttccattatcacagacgatgtggtggacatagcaggagaagagcacctgcccgtgctggtgaggtttgtcgatgacgcccataacctgagagaggagtttgtgggatttctgccgtatgaagctgatgcggagattttggctgtgaaatttcacactacaataactgagaaatggggattgaatatggagtattgtcgtggtcaggcttacattgtgtccagtggattttcttccaaaatgaaagttgttgcttcaagacttttagaaaaatatccccaggctgtctataccctctgttcttcctgtgccttaaatgcatggttggcaaagtctgtccctgtgatcggggtgtccgtggctttaggaaccattgaggaggtctgttcttttttccatcgatcaccacagctgcttttagaacttgacagtgtaatttctgttctttttcagaatagtgaagaacgggctaaagaactgaaggaaatttgtcattcccagtggacaggcaggcatgatgcctttgaaatcttagtggatctcctacaagcacttgtcttatgtttagatggtataataaatagtgacacaaatgttaggtggaataactatatagctgggcgagcatttgtcctctgtagtgcagtgacagactttgatttcattgttaccattgttgttcttaaaaatgtgttatcttttacaagagcctttgggaagaacctccagggacagacctctgacgtcttctttgcagccagcagcctgactgcagtactgcattcacttaatgaggtcatggaaaatattgaagtttatcatgagttttggtttgaggaagccacaaatttagcaaccaaacttgacattcaaatgaaactcccagggaagttccggagagcccagcaaggtaacctggaatctcagctaacctctgagagttattataaagacactctcagtgttccaacagtagagcacattattcaggaacttaaagatattttctctgaacagcacctcaaagctctgaaatgcctatctctggtaccctcagtgatggggcagctcaaatttaacacatcagaagagcaccatgctgacatgtacagaagtgacctacccaaccctgacacgctctctgccgagcttcactgttggagaatcaagtggaaacacagagggaaagatatcgagctcccgtccaccatttatgaagccctccatcttcctgacatcaagtttttccctaatgtatatgctttgctgaaggtcctgtgtattctccctgtgatgaaagttgagaatgagcgctatgaaaatggacggaagcgtctcaaagcatacctgcggaacactctgacagaccagaggtcaagcaatttggctttgcttaacataaattttgatataaaacatgatttagatttaatggtggacacatacatcaaactctatacaaataagtcagagcttcctacaattaattcagaaaccattgaaaatacctagaagattttaaaaatggctgttatcttattttgctgtttggaagaaaagctgtaaggtatagtaggccagataatgacttgctgatagacctccagtttaacatactattagctattggtaatccacgtgtttaaatggcccctgtttgaacactcatgctttcaatacctgtctgttcttccagaagttggcattaggagtgccaaaatacctctgctggtggcactctgaaaatgttttacttaaaagtcgttttaggggctggagaaatggctcagcggttaagagcactgactgcctttccagaggtcctgagttcaagtcccagtgaccacatggtggctcacaaccatctgtaatgggatccgatgccctcttctggtgtgtctgaagagagcaacagtgtactcatatacgtaaaataaataaatctcttaaaaagtcattttagatatgacattatcactgtcgatccagttgtcagttattaagttatcaggtctttggaaaatgaattttgtgagagaaatacattttataatgtgtcatgatgaaaaacaccattgactttgacttggagtttcaggtgtttccgagctgtggtagcagcacttgggaggcagaggcatgaggatgacaggctttaggcctggaccacatagtgagcctgcttcaaagaacgagtgagggctgactggggtggagcctagtgtggagctcttgcctcagtactcaaaagcaaaaagaacagcaaaagtcacaggaagtaacgagcagccttctgtgtagatcctgtcagggcagaagaacctcaaaggaacaagttacagtagcagagccagccctgctgctcctcacttgattgctgctgtttgcatttctttgctgagcccacattttcataggcttgtttgctattcacttgtgcttcatggagaagaaagacccagaggccatccctataggcagctgacttgtctgttgtctccttacatgactgtgtctgctgccttggctcggttataagcaaaacctacagaaataaatgttttgtggtttatctaaaaataatacagaaaatattgctgttatttttggtgaataaaatcaattttgtatagtttatttcaacctaaataaaatgtgaattttgtttaaatttcaggtgaggtgtttttggtgggtcagaatacatccttgtatattttcttaaaATGGTTATTTCATAATCAGCCTCATGCCTTTTACGATTCAAGATGAAGTATTTTCTAGCTTTTCTCTT

This mutation is a 3412 bp deletion beginning at Chromosome 7 position 98,714,706 bp and ending after 98,718,117 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
54669 TGA ACA GCA CCT CAA AGC TC Wild type Forward A
54670 TAC ATG TCA GCA TGG TGC TCT Wild type Reverse A
54671 GGC CTT GGG CAA GTT ATT TAC Mutant Forward A
54672 AAG GCA TGA GGC TGA TTA TGA Mutant Reverse A
54674 Fluorophore-1 ATG CCT ATC TCT GGT ACC CTC AG Quencher-1 WT Probe
54675 Fluorophore-2 CAG AGG GAT TGA TAC CAT CTT CC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
54669 0.40 uM
54670 0.40 uM
54671 0.40 uM
54672 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.