For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr1:20733850+20733951 102bp GGCAGCCTAAACAGAGACC GCTGAAAATCAATAGCACGAAC
Mutant= 106 bp
Wild Type = 102 bp
Wt Sequence: GGCAGCCTAAACAGAGACCCGCGGCTgacccctaagaaacccccacgtttctcagcaaacttacttgcatttttaaaacagttcgtgctattgattttcagc
Mutant Sequence: GGCAGCCTAAACAGAGACCCGCGGCTagcagatctctcgaggttaacgaattccgccccccccccctaacgttactggccgaagccgcttggaataaggccggtgt
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
13007 | ACA CCG GCC TTA TTC CAA G | Mutant Reverse | A | |||
35590 | GGC AGC CTA AAC AGA GAC C | Common | A | |||
35591 | GCT GAA AAT CAA TAG CAC GAA C | Wild type Reverse | A | |||
35592 | Fluorophore-1 | AGC AGA TCT CTC GAG GTT AAC G | Quencher-1 | MUT Probe | ||
35593 | Fluorophore-2 | CCC TAA GAA ACC CCC ACG | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
13007 | 0.40 uM |
35590 | 0.40 uM |
35591 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |