For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 035593
Protocol 19554: Probe Assay - Tg(Alb-cre)21Mgn-Chr13 Alternate2
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 175 bp
Wild Type = 178 bp
This assay is capable of distinguishing hemi from hom.
Sequence
Wt Sequence:
ccagggcaaaacctcaaaactctgtactggacatttctcaaggccaggtcaatgcaaacatcacatgcacacggtttggaagtgctgccctacaagggctCTGActcaacccattttagacataatagttgactttgaccttcaaattgacagg
tcctatgtgaaacataaagattttggaatttcagaagattaacaaacgtagcatacagaacaaaatatggtgcacgatcagcatcaccctgttctgagtcaagatttttg
Mutant Sequence: ATCAAAGAAGTAAGCTCCACCTTAGAAAAAAGTGGAACGTCATGCTAaggACTCAACCCATTTTAGACATAATAGTTGACTTTGACCTTCAAATTGACAGGTCC
TATGTGAAACATAAAGATTTTGGAATTTCAGAAGATTAACAAACGTAGCATACAGAACAAAATATGGTGCACGATCAGCATCACCCTGTTCTGAGTCAAGATTTTTGTTTTGTTTTGTT
TTGTTTTgttttgttttgttttgttttgttttgttttatatccatggctggcaggcatattag
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 20239 | TGC AAA CAT CAC ATG CAC AC | Wild type Forward | A | |||
| 28843 | CGT GCA CCA TAT TTT GTT CTG T | Common | A | |||
| 28844 | CAA AGA AGT AAG CTC CAC CTT AGA | Mutant Forward | A | |||
| 28845 | Fluorophore-1 | CCT ACA AGG GCT CTG ACT CAA CC | Quencher-1 | WT Probe | ||
| 28846 | Fluorophore-2 | AAA GTG GAA CGT CAT GCT AAG GA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 20239 | 0.40 uM |
| 28843 | 0.40 uM |
| 28844 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.