For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 035514
Protocol 31261: Probe Assay - Cd19<tm1(cre)Cgn> Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 88 bp
Wild Type = 91 bp
>chr7:133557873-133557963 91bp ACCAGTCAACACCCTTCCTG TTGACAATCACTAGCAAGATGC
Sequence
Wt Sequence:ATCGAGGTAACCAGTCAACACCCTTCCTGgagctgagccccgggtcCCCTGGCCTGGGATTGCACGTGGGGTCCCTGGGCATCTTGCTAGTGATTGTCAATGTCTCAGACCATATGGGGGGCT
Mutant Sequence: GACTCCTCACCTGTCTCTTCTGAGAAGCTGGCTTGGTATCGAGGTAACCAGTCAACACCCTTCCTGtagctgagcccccggtcgaccatgcccaagaagaagaggaaggTGTCCAATTTACTGACCGTACACCAAAATTTGCCTGCATTACCGGTCGATGCAACGAGTGATGAGGTTCGCAAGAACCTG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 23355 | TGG TGT ACG GTC AGT AAA TTG G | Mutant Reverse | A | Cre | ||
| 36495 | ACC AGT CAA CAC CCT TCC TG | Common | A | |||
| 36496 | TTG ACA ATC ACT AGC AAG ATG C | Wild type Reverse | A | |||
| 36497 | Fluorophore-1 | CAT GCC CAA GAA GAA GAG GAA GG | Quencher-1 | MUT Probe | ||
| 36498 | Fluorophore-2 | CCC TGG CCT GGG ATT GC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 23355 | 0.40 uM |
| 36495 | 0.40 uM |
| 36496 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.