Protocol 38021: Probe Assay - H2az1<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr3:137864556+137864710 155bp AGTATAAAGGGCGCGAGGA ACTCTTCACGTTACCATCTCG

Mut= 162 bp

Wt= 155 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence (deletion in lower case):

GGACGCCAGCGCGCGCTCCTCCCCAGCCTTCCAGCTCCTCCCTCCAGGCACGTGACACCACCGTCCACTCGCTCGGTGGCGCAGCGCTCTGTTGCTGCCCTCCCGCCGCGGCGCCCCTTCTTCTCCCGGTCCTCGTCCCGCCGCATCTCCTCCCCCCCTAACTCATCCCCCACGCGCCAATCATCGCTCGAGCTCCCGAGCGCCCGCCCCGCCACTCCGctgtgcgttctcccattggctggagcctcaaggacgcgtcccgagggcgggaggcaaccattggtgggccgaaccggccgagttcccggatgagggaacattctgcagtataaagggcgcgaggaaggcgggagacggcgcagtttgaatcgcggtccgacggaggagtgggcgctgggatctcgctgagcgtccgcctggcctcgtctcttcctcgctcgtcggagcttcagcacggtccgagatggtaacgtgaagagtgacggcgggcggccgcgggctgcaggctccgagcgggcggggccgccgtccccggggctgggagaggcggcggcggcggcgagtgggagcgtgcggggacggggtcgggacgagcggaggggaggtgttttcggagccccggagctccaggcgggaggcgacggttgggggggcgcgcacggcgcggctgggagccggcgcgggggcgcgcagccgcggcgggctcgcggcaggggtcggcgggggagaagggcgggcggggggcgagcggcggcccggggtccccggcggggcgggcggcgggcggccgagcgcgcgctcgctcgcctccaggacgcgctgtggtgggggaggggcgcgccgccttggtaattctatcttctccgtccctcccgggctcgcgggcgtcggcggcgccgcaggctggcggtaaggctggaaaggactccggaaaggccaagacaaaggcggtttcccgctcgcagcgagccggcttgcaggtgggtagcaactgccgcagtcgggtgaccgggcctttatgtttgcaccccccttgcttgtttgtctgcaccctccatgggtgttccatcttagcatgagtgatgtgtcgcgacttggccctgcggagacagtgaatactggggtttggggagggggggcgtcggatcacatgtgtgttaactggcggggcgcgttggtgcaccaccaccgtccttggctttggcgcgcacatcttatcttaacgaatttcctatctttgtgcattttttttcttgtttgttcgtttgtttgtgtgcataaaaatcaagttccctgtgggccgtattcatcgacacctgaaatctaggacaaccagccacggacgtgtgggcgcgaccgccgctgtgtacagcgcagccatcctggagtacctcaccgcagaggtaagcgggagtacgcctgtgatctggaaaagctctgggggggcgggggaaagtggcgagagaggaggaaagtgatgcaagaaaactcgcaggccctaagagcggcgcgcagaccgagggagcgctagagggagctcgcgttcagccgaggaggctgctgggccagagtgtgctgctcctgcaaatgcaattgcgtgccccttcggggttttttgggtggttttttttttttttttgcataattctgcataattttatcattcaggtagtagggaatgacaacagttggtaaataacaccattgaggttcaaagatcttgattgaaagtaagttggaatattgatcatcagatttttatttattttttgccttttaggtacttgagttggcaggaaatgcgtcaaaagacttaaaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattggattctctgatcaaagctaccattgctggtggtggtatgtcatccctaaactcctaacattctatttaagaagaaaattcctacactcccattgtttctagaagagatttcagtacagggtgctttcatggggtttggctttccacttagtttttgctaagatcattgttcatccctcaagttttcactttgtatatgaattttacctgctttgagttcatgtattgtttttttaaatgtttatccagaaggtagacttaatctgtgtccctctcctaggtgtcatcccacacatccacaaatcgctgatcgggaagaaaggacaacagaagactgtttaaggatgcctggattccttattatctcaggactctaaatattcctaacagctgtccagtgttggtgattccagtggactgtatctctgtgaaaaacacaattttgcctttttgtaattctatttgagcaagttggaggcttaattagccttccaaccaaccaaatttctgcattcgagtcttaaccatatttaagtgttactgtggcttcaaagaagctattgattctgaagtagtgggttttgattgagttgactgtttttaaaaaactgtttggattttaattgtgatgcagaagttatagtaacaagcatttggttttgtacagacattgtttccactctggtggataagctcaataaaggtcatatcccaaactagctttaaacttgcttaataatcgggacttaccttagatctcactcagcaacaagtacattctctgcttactaattaaacagtgcatctgtagtcataaccccgtggtacttttgttgtttctttgtatcatatgacctcttagggtcttaaaacttgggaagaagctggaggtaactgcttttggcgtcccccccccccccaattgacagttaactaatgtgaaagggcctgtatcctaaggtgggacacaagtacagagaccctcagggtacaacgaaagtacctccaCCGAATGAACTTCGGATATAATTTGCTTTTAGTGACCAGACACAGGTGTGAAATGCTAGTCACATCTTGATTCATGCCAAGCATGTTCCATTATTATACATTGACCCCTTTCCCCTCCCTGAGCCTTAAGACATGTATCCTAATTCCTGGAGCAAATCAAACAGAATAGGAGGTGCTTAAGCAGCCTATGTGGATGAAAGAACTTCCTGCCTTACAGCTG

This mutation is a 2664 bp deletion beginning at Chromosome 3 position 137,864,450 bp and ending after 137,867,113 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
52793 AGT ATA AAG GGC GCG AGG A Wild type Forward A
52794 ACT CTT CAC GTT ACC ATC TCG Wild type Reverse A
52795 TCT TCT CCC GGT CCT CGT Mutant Forward A
52796 GAC TAG CAT TTC ACA CCT GTG T Mutant Reverse A
52797 Fluorophore-1 CGC AGT TTG AAT CGC GGT C Quencher-1 WT Probe
52798 Fluorophore-2 CCA CTC CGC CGA ATG AAC TT Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
52793 0.40 uM
52794 0.40 uM
52795 0.40 uM
52796 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.