Protocol 37927: Probe Assay - Tbcc<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr17:46890543+46890692 150bp CAACGCGAAGAAACCAATAG CATCTTGACTCCAGGCTTCC

Mut= 98 bp

Wt= 150 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence (deletion in lower case):

GCAGCTGCCGCTGCTGCAACTCACCCCACAATCCCGGATATAAGTCCTGCCCCTTTAAGAAGAAAAAAAAAAAAAAAAAAAAAGCTTCACCCGACTGCCTCCCACCCCACCCATCCACCAGGACCTTTGTCTCCCCACCCCCTCCTGTCAGCCGGCCCCGCCCTCCTTCCCGCCCCTCCAACGCGAAGAAACCAATAGGCGAGGAGaatatggagggagctgacgtcaccgcagctggccaatcacagcgcgcgttggtgggaggcctcgcgcggagagcgagcgctcggaggcaaggcggcgggggaggaagcctggagtcaagatggagggtgtggactgctccatggctctggccgacgctgccgctggctccccgcgggacctgagcctggtgcccgagcgacttcagaggcgcgaacaggagaggcagatagaggtggagagacgcaagcagaagcggcaggaccaggaggtggaggaggagaagagcggcttcttcgccgccgccttcgcccgggagcgcgcagcggtcgaggagctgctgcggggcgaggcgtcggcggagcggctggaagaggcggccaaccggctccagggcctgcggaagctcctgaacgactcggtgctcttcctcgccgcctacgacctgcggcagggccaggcggcgttggcgcagctgcaggctgtcctaacggaacgtcgccaggagttgcagcccaagaagcgcttcgccttcaaggcacggaagaaggatgctgcggggaccgcccaggtagacgccgcacccgtcgcctcggcggccccttctccaccggtgaccaaggaggaggagggagctcccggggccagctgggcctgtggcttctccaacctggagtcccaagacctggagaagagagctgaagagctgcaccagcgcgacgtccttttgagcgacctgaccaactgcactgtcaaactgtgtggcaatcccaacaccttgcggcttgcgaaggcccgcggctgcaaggtgctctgcggcccagtgaccacctctgtgtttctggaggattgtcgagattgcgtcctggctgtggcttgccagcagctccgtgtgcacactaccaaagacacgcgcgtcttcttgcaagtgaccagcagggctatcgtggaggactgcagcggcatccagtttgccccttacacctggagctacccggggatcgacaaggacttccaggactccggtttagataggagcaaaaataactgggaccaggttgatgatttcaactggctggcccgaaacgtggcctccccaaactggagtattcttcctgaagaggagagagacatccagtgggattgagcactggccacactcagtgtgatgtcccattcggtttacctgatattgtcttatgtttgcggtgataggggttagaaattgttgaaactcccctcctgtgagtcctattaaattcatagcagtgtaacagacttttgctggtttggccttcccctgcctccctttgagTATGACAGCGTGAAGAATTAGGGGGAGAATGGAGGAGCTTTGAGGGATTTGCTGTTCTTACCGTTGATCACAGGGAGTGATAAAGTGGGTCTTCAATAAATAATAAGGATGTCCGGAGAATTCCATTAGCGGACGGTTTAAATGGAAGAAGTAGGCCCATAAAAGCTCCATTAACGGCTGTTTTCCTCCCACTAAAGGTTTGTTCTGTGTCT

This mutation is a 1313 bp deletion beginning at Chromosome 17 position 46,890,571 bp and ending after 46,891,883 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
50196 CAT CTT GAC TCC AGG CTT CC Wild type Reverse A
52533 CAA CGC GAA GAA ACC AAT AG Common A
52534 TGA TCA ACG GTA AGA ACA GCA Mutant Reverse A
52535 Fluorophore-1 AGC TGA CGT CAC CGC AGC T Quencher-1 WT Probe
52536 Fluorophore-2 CGA GGA GTA TGA CAG CGT GA Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
50196 0.40 uM
52533 0.40 uM
52534 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.