For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 122 bp
Wild Type = 148 bp
>chr16:91493132+91493279 148bp TTCATGTTTCTGGGGTTTGG TCTCTTGCTGTCCTGGAACTC
Wt Sequence: ttcatgtttctggggtttgggggtttgtttgtttgtttgtttttcttttttaaaagtacttttgccagactgtggttgtgtaaacctttaacccaagccatggggaaacagagttaggtagacctctgagttccaggacagcaagaga
Mutant Sequence: agagaataggaacttcggaataggaacttcggtcgagataacttcgtataatgtatgctatacgaagttatCCATGGGGAAACAGAGTTAGGTAGACCTCTGAGTTCCAGGACAGCAAGAGA
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
35644 | AGA GAA TAG GAA CTT CGG AAT AGG | Mutant Forward | A | |||
35645 | TCT CTT GCT GTC CTG GAA CTC | Common | A | |||
35646 | TTC ATG TTT CTG GGG TTT GG | Wild type Reverse | A | |||
35647 | Fluorophore-1 | CGG TCG AGA TAA CTT CGT ATA ATG T | Quencher-1 | MUT Probe | ||
35648 | Fluorophore-2 | CCA GAC TGT GGT TGT GTA AAC CT | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
35644 | 0.40 uM |
35645 | 0.40 uM |
35646 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |