Protocol 34505: Probe Assay - Tg(FCGRT)-Chr2-Probe-alternate1
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 116 bp
Heterozygote = 116 bp and 148 bp
Wild type = 148 bp

This assay is capable of distinguishing hemi from hom.  Integration site is known to be on mChr2.

>chr2:100921800-100921947 148bp AGCACTAGACTTCTTGTCAGAAACT TTTCTGTCAGTTAGCTTTATGCTTT

Sequence

Wt Sequence:
agcactagacttcttgtcagaaactatggaagcaagaggagggtagataaactggtttcaagttttagaaGGAAACATATTCCAAagtacagcatttgtattttactttaaaatttaaatcttaaagcataaagctaactgacagaaa
 
Mutant Sequence:
CTCCTGACCTCATGATCCACCCGCCTCTGCCTCCCAAAGGGgtgggattccaAAGTACAGCATTTGTATTTTACTTTAAAATTTAAATCTTAAAGCATAAAGCTAACTGACAGAAATG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
37999 CTC CTG ACC TCA TGA TCC AC Transgene Forward A FCGRT
38003 Fluorophore-1 TCT GCC TCC CAA AGG GGT Quencher-1 Tg Probe FCGRT
43800 AGC ACT AGA CTT CTT GTC AGA AAC T Wild type Forward A mChr2
43801 TTT CTG TCA GTT AGC TTT ATG CTT T Common A mChr2
43802 Fluorophore-2 TGG AAG CAA GAG GAG GGT AGA Quencher-2 WT Probe mChr2

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
37999 0.40 uM
43800 0.40 uM
43801 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
018441 B6.Cg-Fcgrttm1Dcr Prkdcscid Tg(FCGRT)32Dcr/DcrJ
031644 B6.Cg-Tg(FCGRT)32Dcr Albem12Mvw Fcgrttm1Dcr Prkdcscid /J
025201 B6.Cg-Tg(FCGRT)32Dcr Albem12Mvw Fcgrttm1Dcr/MvwJ
029686 B6.Cg-Tg(FCGRT)32Dcr Fcgrttm1Dcr Ighg1em2(IGHG1)Mvw/MvwJ
034902 B6.Cg-Tg(FCGRT)32Dcr Tg(K18-ACE2)2Prlmn Fcgrttm1Dcr/J
028615 NOD.Cg-Fcgrttm1Dcr Prkdcscid Il2rgtm1Wjl Tg(FCGRT)32Dcr/J
6 strains use this protocol