Homozygous Mutant = C/C (SJL/J)
Heterozygote = A/C
Wild type = A/A (C57BL6/J)
>chr2:99216856+99217140 285bp TGTTGGAACTTTGTGCTTGG AACAGATGTCAAATAGGACAACAC
This assay detects a SNP between C57BL6/J and SJL/J, located approximately 4.7 kb from the transgene integration site. It is capable of detecting all genotypes.
Please refer to notes within the protocol called Tg(K18-ACE2)2Prlmn-Chr2 for a complete description.
In lieu of Sanger sequencing, a HpyCH4V cut site is created by this SNP in SJL/J. Two products of 148 bp and 137 bp are present after amplification with these primers followed by restriction digest.
ACTGGCCATGTTTGTGGTCATCTCACTAGGCCCACAAGCTTATTTCAGTAGTATTCTACTCCTTCTTAGGCATCTCTTACCAGACAAGTATTATCATTTAGCATTTG(a/c)AAAGCAGTTATTTTCCAGGGTTTTTTTGACAGAAGTGTGCGAAAAATAAGGCAAGCTACATGTAGAAACTGTTTATACCATCTTTTTTCTTATTCCCATTTTTAGAGGATAGATGTGTTGTCCTAT
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
53435 | TGT TGG AAC TTT GTG CTT GG | Forward | A | |||
53436 | AAC AGA TGT CAA ATA GGA CAA CAC | Reverse | A |
Component | Final Concentration |
---|---|
ddH2O | |
Kapa 2G HS buffer | 1.30 X |
MgCl2 | 2.60 mM |
dNTPS-kapa | 0.26 mM |
53435 | 0.50 uM |
53436 | 0.50 uM |
Glycerol | 6.50 % |
Kapa 2G HS taq polym | 0.03 U/ul |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 94.0 | -- | |
2 | 94.0 | -- | |
3 | 65.0 | -- | -0.5 C per cycle decrease |
4 | 68.0 | -- | |
5 | -- | repeat steps 2-4 for 10 cycles | |
5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
6 | 94.0 | -- | |
7 | 60.0 | -- | |
8 | 72.0 | -- | |
9 | -- | repeat steps 6-8 for 28 cycles | |
10 | 72.0 | -- | |
11 | 10.0 | -- | hold |