Stock No: 034860
Protocol 38275: Sanger sequencing Assay - Chr2_rs13476660-SEQ
Version 1.0

Notes

Homozygous Mutant = C/C (SJL/J)
Heterozygote = A/C
Wild type = A/A (C57BL6/J)

>chr2:99216856+99217140 285bp TGTTGGAACTTTGTGCTTGG AACAGATGTCAAATAGGACAACAC

This assay detects a SNP between C57BL6/J and SJL/J, located approximately 4.7 kb from the transgene integration site.  It is capable of detecting all genotypes.

Please refer to notes within the protocol called Tg(K18-ACE2)2Prlmn-Chr2 for a complete description.

In lieu of Sanger sequencing, a HpyCH4V cut site is created by this SNP in SJL/J.  Two products of 148 bp and 137 bp are present after amplification with these primers followed by restriction digest.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

ACTGGCCATGTTTGTGGTCATCTCACTAGGCCCACAAGCTTATTTCAGTAGTATTCTACTCCTTCTTAGGCATCTCTTACCAGACAAGTATTATCATTTAGCATTTG(a/c)AAAGCAGTTATTTTCCAGGGTTTTTTTGACAGAAGTGTGCGAAAAATAAGGCAAGCTACATGTAGAAACTGTTTATACCATCTTTTTTCTTATTCCCATTTTTAGAGGATAGATGTGTTGTCCTAT

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
53435 TGT TGG AAC TTT GTG CTT GG Forward A
53436 AAC AGA TGT CAA ATA GGA CAA CAC Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
53435 0.50 uM
53436 0.50 uM
Glycerol 6.50 %
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.