Protocol 37521: Probe Assay - Skor1<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr9:63143523-63143642 120bp AGGTAGCTCTCAGGAAGTGAGC GTGGATTTGGGATAATCTTTGG

Mut = 128 bp

Wt = 120 bp

Fam = Mut

Hex = Wt

 

Sequence

Wt Sequence (deletions in lower case):

AGGTAGCTCTCAGGAAGTGAGCATAGAACGTgggggtggctttggacagccgctggcttgaaagcggctttgtgttttaagtaatttgttccggagtaccaaagattatcccaaatccactacggtacgtcatcactgcgttcaggtctccagggcccaccaacctctgccacactctcgtccttcctgttggcccgctgggcaagggtgtcccgcctaatcgcctgtcattttcggccgtcgcaggtgtatgcgcctgaaagggacgaacacgtgaagagtacggcggtggcggcggcgctggggcccgcggcctcttacctctgcaccccagagacccacggtaatgcctcctgaggtctctggcccttttaatGCAGGAAGTACAGAGAGAACCCAGAGCCAAGGCAGGCCTTTCAAGGAAGGGAGGGGCGGAAAGAGACGGAGAGAAA

This mutation is a 345 bp deletion beginning at Chromosome 9 position 63,143,267 bp and ending after 63,143,611 bp (GRCm38/mm10). There is a 2 bp insertion (AC) at the deletion site. 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
51574 AGG TAG CTC TCA GGA AGT GAG C Common A
51575 GTG GAT TTG GGA TAA TCT TTG G Wild type Reverse A
51576 CCC TTT CTC TAT CAC CCC TTT TC Mutant Reverse A
51577 Fluorophore-1 CTG GCT TGA AAG CGG CTT T Quencher-1 WT Probe
51578 Fluorophore-2 TAC GCA GGA AGT ACA GAG AGA ACC C Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
51574 0.40 uM
51575 0.40 uM
51576 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.