Protocol 37443: Probe Assay - Isy1<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr6:87825430-87825537 108bp GAGCAGGCTTGTGTGTCAGA TAACCTCGATTTCCTGGGACT

Mut = 115 bp

Wt = 108 bp

Fam = Mut

Hex = Wt

 

Sequence

Wt Sequence (deletions in lower case):

CATTTTTTTAAGCTTACTTTTTTGTGGTGCTGGGAATCGAGCCAGGGCTACTTGCATGCTAGACAAACACTACTGAGCCACATCTCTCTAGGGTCACTTTTAAgggttttgaaaacagtgcacaaatgttcttctatatagagtgtttttcatgtgtgaccttattatctcaaattgtattgtgaacaaaagagcaggcttgtgtgtcagatctattcttcctctttctttcccaacaagaaagttggccccaagatgctggatcatgaaggtaaagaagtcccaggaaatcgaggttacaagtactttggggcagcaaaagatttgcctggtgtcagagagctatttgagaaagaacgtaagtagttcatgtgtttgagagtgcgttggcctttaattgttgctactgagtgagagaagtatgctgtatgctatctggtaggaattattgctcccagattttaaaaaatagtttaaaatttgtattcctaagtttattctatatttttgtagcatggtctcatgtacccccagGCTTTGAATGCCTCATCTTCTTATATCCACCTGTTAGGAATATAGACATCTATCCTTTTTGTTAAAAAACAAAAAACAAAAAACAAAAAAACCATTGTTCACGCTGGCCTAAGACTTGCCAACTAACTTCTGTCTCAGCCTTCATAG

This mutation is a 431 bp deletion beginning at Chromosome 6 position 87,825,195 bp and ending after 87,825,625 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
51347 GAG CAG GCT TGT GTG TCA GA Wild type Forward A
51348 TAA CCT CGA TTT CCT GGG ACT Wild type Reverse A
51349 GAG CCA GGG CTA CTT GCA T Mutant Forward A
51350 GAT GTC TAT ATT CCT AAC AGG TGG A Mutant Reverse A
51351 Fluorophore-1 AGT TGG CCC CAA GAT GCT Quencher-1 WT Probe
51352 Fluorophore-2 CCA CAT CTC TCT AGG GTC ACT TTT AAG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
51347 0.40 uM
51348 0.40 uM
51349 0.40 uM
51350 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.