For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 034722
Protocol 37395: Probe Assay - Vps36<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:22202154+22202249 96bp GCAGAGAGGGAGCAGTTTCT GCTGCGTTACACTCATCAGAAG
Mut = 93 bp
Wt = 96 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
GAACACTTGCCGGGCAGAGAGGGAGCAGTTTCTTTAAGGATTACAGCATTGTTGTTTTTAAGTACctcctagggaacagcgctctatcttctgatgagtgtaacgcagctctttttctgtgggtttcctctaggagtgctgcatggccattcccctgtctcagattgtgttcatcgaggagcaggcagctggaatcgggaagaggtgaggtctaacagtcctcagtcacaaaaccatttcctgtcactggtcagtaggccttttaagggtgtgtttccaccttatatccattttgaagtctgaataaagtggtaaggcttgctgtaatatccttgcatcataataaatgatggggccctgctcttacCGTATGTATTTCCACAGCACGCTTGTCGTTCATGTGTGTGCATTATTCAGTATTTAAACTCAGGAATGCCTCAGCTGAGGGAAAGAACTATTAATGTTGATAACTTATTGGTAACC
This mutation is a 302 bp deletion beginning at Chromosome 8 position 22,202,206 bp and ending after 22,202,507 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51242 | GCA GAG AGG GAG CAG TTT CT | Common | A | |||
| 51243 | GCT GCG TTA CAC TCA TCA GAA G | Wild type Reverse | A | |||
| 51244 | GCA CAC ACA TGA ACG ACA AG | Mutant Reverse | A | |||
| 51245 | Fluorophore-1 | CTC CTA GGG AAC AGC GCT CT | Quencher-1 | WT Probe | ||
| 51246 | Fluorophore-2 | AGT ACC GTA TGT ATT TCC ACA GCA C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51242 | 0.40 uM |
| 51243 | 0.40 uM |
| 51244 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.