For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 034692
Protocol 37750: Standard PCR Assay - Col1a1<tm#(tetO-MAPT*)Mdk>-alternate3
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 292 bp
Heterozygote = 199 bp and 292 bp
Wild type = 199 bp
>chr11:94953435+94953633 199bp CCATCCCAACAATACATCACA TGGTTTCTTTGGGCTAGAGG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 25360 | TGG TTT CTT TGG GCT AGA GG | Wild type Reverse | A | Wt R | ||
| 31015 | CCA TCC CAA CAA TAC ATC ACA | Wild type Forward | A | Wt F | ||
| 52062 | ACA CTG TTC TTT GTG TGA GTG G | Mutant Forward | A | mCdx1 | ||
| 52063 | ACA CGC CTA AAG CTT ATA CGT TC | Mutant Reverse | A | TRE3G promoter |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 25360 | 0.50 uM |
| 31015 | 0.50 uM |
| 52062 | 0.50 uM |
| 52063 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.