For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 034667
Protocol 37309: Probe Assay - Ppa2<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:133320859+133320973 115bp TCAAAAAGCAGCCCAGGAC GTCGTGGAAAGGGGAGATGT
Mut = 116 bp
Wt = 115 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
AACTTTTAAGGTGTGAAGTTAGCTTTGCAAAAAGCACACAAGTTCAAAAAGCAGCCCAGGACCTCCTTTCGATAAAGAGCAGCGCGCgcggcggtaactctgtgcctattttctttacagagcatgtagctggtcattacatctcccctttccacgacattcctctgaaggcggactgtaaagaggtattgtttttacttgtttgggggatgaagaacttcctgtacacgatatatcaaaatgcttcactattgcccaaaagatgcctttaaagtgaagatgtggttggcaggcaggggaagaaaccaagGAGCTAGAATGGGGCAGTAAGCCTCTGTTCTAAATTAAAATTTGTATGAGGCCAGAAGAAAGGGAGGCATTTACAGACTATGAAGTTTAGACTGCAGTGAGAATTGAAGTAATATGGGA
This mutation is a 223 bp deletion beginning at Chromosome 3 position 133,320,903 bp and ending after 133,321,125 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51030 | TCA AAA AGC AGC CCA GGA C | Common | A | |||
| 51031 | GTC GTG GAA AGG GGA GAT GT | Wild type Reverse | A | |||
| 51032 | AAA TGC CTC CCT TTC TTC TG | Mutant Reverse | A | |||
| 51033 | Fluorophore-1 | CGG TAA CTC TGT GCC TAT TTT CTT T | Quencher-1 | WT Probe | ||
| 51034 | Fluorophore-2 | ATG GGG CAG TAA GCC TCT GT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51030 | 0.40 uM |
| 51031 | 0.40 uM |
| 51032 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.