Protocol 37086: Probe Assay - Wdr25<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr12:108980478+108980563 86bp ACTGTGTCGATGTGGTCAGC CCTTTCTCCAGGGCTAAGGA

Mut = 84 bp

Wt = 86 bp

Fam = Mut

Hex = Wt

 

Sequence

Wt Sequence (deletions in lower case):

TCGTAAGCCGCTTGCAGGAGTCAAGTGTGTACTGGACATCCTCCCAGGAGCCTCATCCCCGTGGAGAgccaggatgagggggaggggaaggtaccccttgcttaagaagaggttaccaccgccccccccgccccccccagctccttgagctctgaggctggcccctttctgggtctcagtcaactatggtctgactgggtgctctctccattccaggacaggtagcagactgtcgaaggcaggggcaggactgtgtcgatgtggtcagcaggtaggagcgggtgtgaaggctgagtggagacaggagatgctgtttccttagccctggagaaaggagacctgtgctttgctgtgaggaagagagactctagctgccagttagatgtgaaattgtgggaccccaacctcctggggttccttcatcacggtgactggtgctgcctgtctttgtttcccttgcaggtgtggaatgctgtggactcgggacactgcctgcagacctactctgtgcacagtgaggcagtaagggctgcacggtggtctccctgtggccggcgcatcctcagtggtggcttcgactttgccctgcacctaacagaccttgaaacaggtgtgtcctaacgtcctaactgtctctggtcagccagcagccccctcactggggaagcctcctcagcgggtcctgactgcagactgtctatggtgacggtgtggcagaggcctcaggacatgcctacggGCATGCAGATCATTTGCCAGCAGCACCACAGCTGTCTACAAAGCATTGGAAGCAGTCCTCTGCCAGTCAGCAAAGGACAGAGCCAAG

This mutation is a 672 bp deletion beginning at Chromosome 12 position 108,980,296 bp and ending after 108,980,967 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
48376 GCT TGC AGG AGT CAA GTG TG Mutant Forward A
50470 ACT GTG TCG ATG TGG TCA GC Wild type Forward A
50471 CCT TTC TCC AGG GCT AAG GA Wild type Reverse A
50472 GTG CTG CTG GCA AAT GAT CT Mutant Reverse A
50473 Fluorophore-1 AGC GGG TGT GAA GGC TGA GT Quencher-1 WT Probe
50474 Fluorophore-2 CTC ATC CCC GTG GAG AGC AT Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
48376 0.40 uM
50470 0.40 uM
50471 0.40 uM
50472 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.